Your Perfect Assignment is Just a Click Away

We Write Custom Academic Papers

100% Original, Plagiarism Free, Customized to your instructions!

glass
pen
clip
papers
heaphones

PHA 6535 University of Florida Nucleotide Activity Questions

PHA 6535 University of Florida Nucleotide Activity Questions

I’m working on a biology multi-part question and need an explanation and answer to help me learn.

  1. Discuss the function in detail of each of the following RNA polymerase II transcription factors.
    1. TFIIB
    2. TFIIE
    3. TFIIF
    4. TFIIH
  2. What additional role does one of the subunits of TFIIH have during the initiation phase that involves other protein kinases? What is the end result?
  3. Discuss in detail how the 5’ cap is formed in eukarytotic mRNAs.
  4. What makes the 3’ end of eukaryotic mRNAs unique? Describe how this is added.
  5. What are the five snRNAs involved in splicing reaction, and describe briefly how they work to assemble spliceosomes.
  6. What step in de novo purine nucleotide synthesis is the first committed step, and what happens in this step? Why is the carboxylation that takes place in step 6 of the de novo purine nucleotide synthesis unusual?
  7. Describe three major feedback mechanisms that help to regulate the overall rate of de novo purine nucleotide synthesis and the relative rates of formation of the two end products, adenylate and guanylate.
  8. How is thymidylate derived?
  9. What causes Lesch-Nyhan Syndrome? What is the role of the enzyme that is lacking in individuals who have this disease?
  10. Describe the condition known as Gout and include in your discussion how it is caused
  11. What effect does the attenuation of hypoxanthine-guanine phosphoribosyl transferase (HGPRT) have on the de novo and salvage syntheses of purines?
  12. Explain in detail the common feature of the biosynthesis of NAD+, FAD and Coenzyme A (CoA)
  13. Define the following terms: codon, reading frame and peptide sequence (3 points)
  14. Review the following coding DNA Sequence and its template strand, and provide the sequence
    for the corresponding mRNA strand in 5’ to 3’ orientation: (2 points)
    5’-CCGGCTAAGATCTGACTAGC-3’ (coding)
    3’-GGCCGATTCTAGACTGATCG-5’ (template)
  15. Provide the 3 possible reading frames for the following mRNA sequence and identify any initiation
    or termination codons (5 points)
    5’- GCUAGUCAGAUCUUAGCCGG -3’
  16. Consider the following mRNA sequence, translate each codon into its corresponding amino acid
    and provide the peptide sequence: (5 points)
    5’-CGG CUA AGA UCU GAC UAG -3’

Order Solution Now

Our Service Charter

1. Professional & Expert Writers: Studymonk only hires the best. Our writers are specially selected and recruited, after which they undergo further training to perfect their skills for specialization purposes. Moreover, our writers are holders of masters and Ph.D. degrees. They have impressive academic records, besides being native English speakers.

2. Top Quality Papers: Our customers are always guaranteed papers that exceed their expectations. All our writers have +5 years of experience. This implies that all papers are written by individuals who are experts in their fields. In addition, the quality team reviews all the papers before sending them to the customers.

3. Plagiarism-Free Papers: All papers provided by Studymonk are written from scratch. Appropriate referencing and citation of key information are followed. Plagiarism checkers are used by the Quality assurance team and our editors just to double-check that there are no instances of plagiarism.

4. Timely Delivery: Time wasted is equivalent to a failed dedication and commitment. Studymonk is known for timely delivery of any pending customer orders. Customers are well informed of the progress of their papers to ensure they keep track of what the writer is providing before the final draft is sent for grading.

5. Affordable Prices: Our prices are fairly structured to fit all groups. Any customer willing to place their assignments with us can do so at very affordable prices. In addition, our customers enjoy regular discounts and bonuses.

6. 24/7 Customer Support: At Studymonk, we have put in place a team of experts who answer all customer inquiries promptly. The best part is the ever-availability of the team. Customers can make inquiries anytime.