Your Perfect Assignment is Just a Click Away

We Write Custom Academic Papers

100% Original, Plagiarism Free, Customized to your instructions!

glass
pen
clip
papers
heaphones

Answer The Following Question

Answer The Following Question

1. Take a look at Extended Data Figure 3 from Huerta-Sánchez et al (2014). How does this figure emphasize that the Tibetan allele for EPAS1 came from Denisovans? (10 points)

2. You are given the following seven aligned sequences from a single population (variants with respect to the first sequence are shown in bold). Justify whether or not you see any evidence of selection. (20 points)

TGGAGTGTGACCATAGCGAT
TGGAGTTTGACCATAGCCAT
TGGAGTGTGACCATAACCAT
TGGTGTTTGCCCATAACGAT
TGGTGTGTGACCATAGCGAT
TGGTGTGTGCCCATAGCGAT
TGGAGTGTGACCATAACGAT 

3. Explain the concept of the “Neutral Theory of Molecular Evolution” and how it relates to the idea of a molecular clock? (10 points)

Our Service Charter

1. Professional & Expert Writers: Studymonk only hires the best. Our writers are specially selected and recruited, after which they undergo further training to perfect their skills for specialization purposes. Moreover, our writers are holders of masters and Ph.D. degrees. They have impressive academic records, besides being native English speakers.

2. Top Quality Papers: Our customers are always guaranteed papers that exceed their expectations. All our writers have +5 years of experience. This implies that all papers are written by individuals who are experts in their fields. In addition, the quality team reviews all the papers before sending them to the customers.

3. Plagiarism-Free Papers: All papers provided by Studymonk are written from scratch. Appropriate referencing and citation of key information are followed. Plagiarism checkers are used by the Quality assurance team and our editors just to double-check that there are no instances of plagiarism.

4. Timely Delivery: Time wasted is equivalent to a failed dedication and commitment. Studymonk is known for timely delivery of any pending customer orders. Customers are well informed of the progress of their papers to ensure they keep track of what the writer is providing before the final draft is sent for grading.

5. Affordable Prices: Our prices are fairly structured to fit all groups. Any customer willing to place their assignments with us can do so at very affordable prices. In addition, our customers enjoy regular discounts and bonuses.

6. 24/7 Customer Support: At Studymonk, we have put in place a team of experts who answer all customer inquiries promptly. The best part is the ever-availability of the team. Customers can make inquiries anytime.